Rayap adalah serangga sosial anggota bangsa Isoptera yang dikenal luas sebagai hama penting kehidupan manusia. Rayap bersarang di dalam kayu dan memakan perabotan atau kerangka rumah yang terbuat dari kayu sehingga menimbulkan banyak kerugian secara ekonomi. Rayap masih berkerabat dengan semut, yang juga serangga sosial. Rayap disebut juga semut putih (white ant) karena kemiripan perilakunya. Penampilan rayap memang mirip semut. Tetapi perbedaannya cukup banyak, bahkan semut merupakan salah satu musuh utama dari rayap. Dari segi sistematika/filogenetika semut mendekati golongan lebah, sehingga kedua serangga ini dicakup dalam Ordo Hymenoptera (bersayap selaput).

Jika kita mengamati seekor semut atau seekor lebah, secara morfologik tampak batas yang jelas antara bagian dada (toraks) dan perut (abdomen), bahkan pada beberapa jenis lebah batas ini demikian mencolok sehingga menggenting (dengan pinggang yang sangat kecil). Pada jenis-jenis rayap, batas antara toraks dan abdomen kurang jelas, atau secara awam kita katakan “rayap tidak memiliki pinggang yang ramping”. Individu bersayap yang lazim disebut laron (atau sulung, alata, alates), memiliki sepasang sayap yang dalam keadaan diam cara melipatnya memanjang lurus ke belakang, seperti halnya jenis-jenis belalang dan lipas  berbeda dengan Hymenoptera yang terlipat dalam beberapa simpul, sebelum memanjang ke belakang. Bedasarkan tekstur dan struktur sayap maka rayap digolongkan dalam satu ordo tersendiri yaitu Isoptera (bersayap sama). Beberapa rayap dapat mencapai bentuk bersayap yang akan keluar dari sarangnya secara berbondong-bondong pada awal musim penghujan (sehingga seringkali menjadi pertanda perubahan ke musim penghujan) di petang hari dan beterbangan mendekati cahaya. Bentuk ini dikenal sebagai laron atau anai-anai.

Semua rayap makan kayu dan bahan berselulosa, tetapi perilaku makan (feeding behavior) jenis-jenis rayap bermacam-macam. Hampir semua jenis kayu potensial untuk dimakan rayap. Rayap dapat keluar dari sarangnya melalui terowongan-terowongan atau liang-liang kembara yang dibuatnya. Bagi rayap subteran (bersarang dalam tanah tetapi dapat mencari makan sampai jauh di atas tanah), keadaan lembab mutlak diperlukan. Sebaliknya, rayap kayu kering (Cryptotermes) tidak memerlukan air (lembab) dan tidak berhubungan dengan tanah juga tidak membentuk terowongan-terowongan panjang untuk menyerang objeknya.

Salah satu sebab cepatnya perkembangan teknologi DNA adalah penemuan berbagai macam enzim yang dapat mengkatalisis pembelahan DNA di beberapa tempat yang dapat di produksi. Enzim restriksi adalah enzim yang memotong dsDNA (baca: double stranded DNA) pada situs spesifik. Situs yang dipotong oleh enzim restriksi disebut situs pengenalan enzim (Recognition sequences). Enzim yang berbeda dapat mengenali situs yang berbeda. Enzim yang dihasilkan oleh berbagai jenis bakteri dan secara alami berfungsi untuk melindungi bakteri dari inkorporasi DNA asing. Penamaan enzim restriksi biasanya berdasarkan inangnya, misalnya EcoRI berasal dari bakteri E. coli. Dalam biologi molekuler, enzim restriksi biasanya digunakan untuk analisis kekerabatan, rekayasa genetika dan identifikasi suatu molekul DNA. (Anonim 2010).
Enzim restriksi mampu memotong DNA pada situs pengenal dengan sekuensi DNA yang sangat spesifik (Recognition site). Dengan demikian enzim ini mampu memproses DNA menjadi potongan-potongan yang lebih pendek asal DNA tersebut memiliki situs pengenal untuk enzim restrisi tertentu, dan ini merupakan salah satu tujuan dilakukannya pemotongan DNA. Oleh enzim restriksi ini, DNA genomik tanaman yang relatif kompleks organisasi DNA-nya dapat dipotong-dipotong menjadi populasi potongan DNA dengan berbagai ukuran. Sampai dengan tahun 1988an, telah diketahui hampir 475 macam enzim restriksi yang berasal dari berbagai organisme. Situs pengenalan enzim restriksi kebanyakan terdiri dari empat basa atau enam basa, tetapi ada juga yang selain itu. Pada umumnya enzim restriksi yang berbeda memiliki situs pengenalan yang berbeda, namun ada beberapa enzim yang diisolasi dari sumber yang berbeda memiliki situs pengenalan yang sama. Enzim-enzim seperti ini disebut isoschizomer, contohnya adalah enzim MboI dan Sau3AI. Walaupun situs pengenalannya sama, aktivitas pemotongannya mungkin beda. Sekuen pengenalan biasanya sama urutan basanya pada kedua utas DNA bila dibaca dengan arah yang sama. Sekuen ini disebut palindromik. Berdasarkan ujung hasil pemotongannya, enzim restriksi dapat memotong dengan ujung lengket/lancip (sticky/cohesive end) dan ujung tumpul (blunt end). Enzim yang memotong pada kedua utas tidak berhadapan langsung, tetapi selisih 2-4 basa menghasilkan potongan dengan ujung lengket sedangkan enzim yang memotong pada tempat yang berhadapan menghasilkan ujung tumpul contohnya adalah enzim SmaI.
Hingga saat ini, paling tidak sudah terdapat ribuan enzim yang diperoleh dari berbagai jenis mikroorganisme. Beberapa di antaranya yang terkenal dan sering digunakan adalah enzim EcoRV, HindIII, SacI, TaqI, BamHI,MspI dan lain-lain.

Lokus D1S80 terletak pada kromosom pertama yang merupakan kromosom manusia terbesar, Lokus ini memiliki urutan berulang 16 bp dan bervariasi untuk setiap orang. Ulangan yang bervariasi ini menyebabkan perbedaan dalam panjang situs pada masing-masing orang. Ulangan-ulangan dalam situs ini disebut lokus mikrosatelit. Urutan DNA disekitar lokus D1S80 ini telah diketahui dan identik pada semua orang (universal) (Sambrook 1989).
Lokus D1S80 diwariskan oleh orang tua kepada anaknya. Lokus ini terdiri atas urutan-urutan DNA dengan ulangan (repeat) dan panjang yang sangat bervariasi untuk setiap orang, misalnya AGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTC (10x). Lokus ini memiliki sifat polimorfik yang menyebabkan perbedaan alel ini untuk setiap manusia dan sering digunakan untuk untuk identifikasi individu dengan sidik jari DNA. Sidik jari genetik merupakan salah satu contoh aplikasi untuk mengidentifikasi secara pasti terdakwa kasus kriminal atau uji paternitas. Hanya untuk kembar identik, teknik ini tidak dapat digunakan karena kembar identik memiliki gen yang identik. Pada kasus kriminal, sidik jari genetik menyediakan bukti tentang identitas tersangka yang diduga sebagai pelaku kejahatan (Lewis 2003).
Lokus D1S80 digunakan sebagai situs awal untuk sintesis DNA. Primer D1S80 digunakan karena DNA yang akan diisolasi dan akan diperbanyak mengandung lokus D1S80. Air hasil kumur mengandung mukosa rongga mulut dan enzim-enzim. Saat sentrifugasi, sel-sel berpindah ke arah luar karena beratnya. Penambahan bufer lisis adalah sebagai detergen yang melarutkan sel. (KAC) mengandung potassium asetat yang dapat mengendapkan protein. Etanol 70% digunakan untuk mencuci DNA dari residu potassium asetat. Proses selanjutnya adalah PCR (Polymerase Chain Reaction), denaturasi pada suhu 90 ˚C selama 60 detik menyebabkan heliks ganda DNA akan mengalami disosiasi. Proses annealing pada suhu 63 ˚C selama 60 detik menyebabkan primer-primer akan berikatan dengan DNA pada tempat yang tepat. Proses sintesis DNA pada suhu 72 ˚C selama 60 detik menyebabkan taq polumerase memanjangkan primerprimer sesuai dengan utas DNA cetakan. Proses PCR diulang sebanyak 30 kali, dan putaran terakhir berlangsung selama 5 menit pada suhu 72 ˚C (Watson et al 2008).